Neutrophils to Silently Infect and Propagate in

Macrophages

Werner Solbach1, Steffen Stenger3, Tamas Laskay1, Ger van Zandbergen3*

1 Institute of Medical Microbiology and Hygiene, University of Luebeck, Luebeck, Germany, 2 Medical Clinic III, University hospital Schleswig-Holstein, Luebeck, Germany,

3 Institute of Medical Microbiology and Hygiene, University Clinic of Ulm, Ulm, Germany, 4 Institute of Anatomy, University of Luebeck, Luebeck, Germany

Abstract

Background: Intracellularⁱ pathogens have developed elaborate strategies for silent infection of preferred host cells.

with chronic lung sequelae in adults and children. Within the lung, alveolar macrophages and polymorph nuclear

neutrophils (PMN) are the first line of defense against bacteria, but also preferred host phagocytes of chlamydiae.

macrophages via apoptotic PMN results in enhanced replicative activity of chlamydiae when compared to direct infection of

macrophages, which results in persistenceⁱ of the pathogen. Inhibition of the apoptotic recognition of C. pneumoniae

infected PMN using PS- masking Annexin A5 significantly lowered the transmission of chlamydial infection to macrophages.

direct infection of macrophages with chlamydiae was characterized by an enhanced TNF-a response.

taken up by long-lived macrophages, which allows for efficient propagation and immuneⁱ protection within the human host.

Propagate in Macrophages. PLoS ONE 4(6): e6020. doi:10.1371/journal.pone.0006020

Editor: David M. Ojcius, University of California Merced, United States of America

Received March 3, 2009; Accepted May 19, 2009; Published June 23, 2009

unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Interfaces’’ (RA-If, CHIP). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

* E-mail: jan.rupp@uk-sh.de (JR); Ger.Zandbergen@uniklinik-ulm.de (GvZ)

Introduction

enters the human body after respiratory infection. Infection

activates airway epithelial cells resulting in a rapid recruitment of

polymorph nuclear neutrophil granulocytes (PMN) [1,2]. Consequently,

in the lung, PMN are among the first leukocytes to

within PMN [4]. During the later course of the infection, viable

chlamydiae are found inside alveolar macrophages (AM),

bronchial/alveolar epithelial cells, vascular endothelial/smooth

muscle cells and monocyteⁱ- derived macrophages (MF) [4–8].

Chlamydiae undergo a biphasic developmental cycle inside an

internalized vesicle termed inclusion. Non dividing elementary

bodies (EBs) change into the dividing and metabolically active

reticulate bodies (RBs), re-differentiate to EBs and finally escape

from the host cell [9]. Productive infection and chlamydial

growth can be analyzed by inclusion morphology and size, but

also by monitoring transcriptional activity of chlamydial genesⁱ

involved in pathogen metabolism and pathogenicity throughout

the developmental cycle [10–12]. Increased production of the

demonstrated as markers of direct host immune responses to

chlamydial infections in phagocytes [13,14], which may result in

intracellular killing of the bacteria.

One possible strategy to implement a productive infection is to

silently infect respective host cells. It has been suggested that

chlamydiae can benefit from a silent uptake resulting in increased

survival and growth [15]. The most extensively studied example of

a silent uptake into phagocytes is the clearance of apoptotic cells

which is a well organized three step process [16]. First, apoptotic

cells release ‘‘find-me’’ signals to recruit phagocytes to the site of

apoptotic death [17]. Second, phagocytes recognize the presence

of phosphatidylserine (PS) termed as ‘‘eat-me’’ signal on the

membrane of apoptotic cells [16]. The final step is an active

suppression of inflammation and immune response and can be

termed as a ‘‘forget me’’ signal. This step is characterized by the

release of anti-inflammatory cytokineⁱ TGF-ß and down-regulation

In this study we could show, that C. pneumoniae make use of these

silent entry mechanisms to be taken up by monocyte- derived

PLoS ONE | www.plosone.org 1 June 2009 | Volume 4 | Issue 6 | e6020

macrophages or alveolar macrophages via apoptotic PMN. Thus,

upon activation recruit monocytic phagocytes. C. pneumoniae

infected PMN then become apoptotic as shown by PS and

TUNEL positivity and are ingested by MF and AM, which secrete

increased amounts of anti-inflammatory TGF-ß.

Results

PMN

PMN and remains viable intracellularly, we compared the

Using FACS we could show that 79%62% (n =3) of the HEp-2cells and 83%

positive 66 h p.i. (MOI 1), whereas non-infected cells alone stained

negative (Fig. 1A,B). Microscopically, we observed that intracellular

different, showing multiple, smaller inclusions than in HEp-2 cells

(Fig. 1C,D).

To prove intracellular viability of chlamydiae inside PMN we

analyzed the transcriptional activity of chlamydial genes involved

in pathogen replication and metabolism. Expression of the 16S

p.i. when compared to the 18S rRNA expression of the host cells,

indicating replication of chlamydiae inside PMN (Fig. 1E,

p = 0.02). As a control, co- incubation of PMN with heat-killed

(HK) chlamydiae did not result in detectable amounts of 16S

rRNA (Fig. 1E). Key factors that indicate intracellular activity of

chlamydiae like the RNA polymerase (rpo) and the pyruvate

kinase (pyk) significantly increased within 66 h after PMN

infection (Fig. 1F, p = 0.01 and p = 0.03, respectively).

positive apoptotic PMN

apoptotic 66 h p.i. [4]. Using Annexin A5 (AnxA5) staining to

detect phosphatidylserine (PS) as an early marker of apoptosis on

the outer cell membrane, we could detect that both non- infected

PMN become PS- positive within 66 h (Fig. 2A,B). Additional

increase the amount of necrotic cells compared to non- infected

PMN stain positive for PS we performed a double staining using a

AnxA5 mAb (Fig. 2C). Within 66 h p.i. we observed that

PS on the cell surface (Fig. 2C).

To analyze late apoptotic PMNs we further performed the

TUNEL assay which reveals the apoptotic fragmentation of

PMN became TUNEL- positive, more than 80% stained

positive in the non- infected control 66 h p.i. (Fig. 2D,E).

enter macrophages

Macrophages (MF) represent the first line of defense in the lung

and are supposed to clear the lung from bacterial pathogens as

intracellular positivity of chlamydial LPS by FACS analysis (A, B; representative experiment out of 3) and fluorescence microscopy (C, D; magnification630

rRNA using the DDct- method for relative quantification. Viable (open bars) but not heat-killed (HK, closed bars) chlamydiae showed a significantincrease in 16S rRNA expression (

doi:10.1371/journal.pone.0006020.g001

Apoptosis Driven Infection

PLoS ONE | www.plosone.org 2 June 2009 | Volume 4 | Issue 6 | e6020

well as apoptotic cells. First, we addressed the question whether

resulted in an increased production of MIP-1ß as compared to

mock- stimulated PMN (Fig. 3A). Using an in vitro chemotaxisassay we found, that supernatants taken from

PMN attracted monocytes significantly better when

compared to supernatants taken from mock- stimulated PMN

(Fig. 3B, p= 0.04; n= 3). Having shown that PS- positive apoptotic

PMN harbor viable chlamydiae and subsequently recruit monocytes,

we wondered whether these cells are ingested by monocytederived

PMN with MF, PMN were rapidly engulfed by MF

(15 min) and could be observed within the MF phagosome by

electron microscopy (Fig. 3C).

macrophages

macrophages (MF) and alveolar macrophages (AM) we

analysis. Whereas only 21%65% (n = 3) of MF stained C.pneumoniae

p.i.), co- incubation of MF with C. pneumoniae- infected apoptotic

PMN resulted in significantly higher amount of C. pneumoniae

PMN was still observed 90 h p.i., showing more than 5-fold

more C. pneumoniae LPS- positive cells compared to the directinfection of MF (75%

Increased bacterial loadⁱ in MF that were infected through

MF (Fig. 4C).

To bring the PMN passage strategy closer to respiratory C.pneumoniae

alveolar macrophages (AM) from bronchoalveolar lavage (BAL)

fluid. To analyze difference in the infection pattern of AM that

calculated the amount of small and large inclusions inside these

cells (Fig. 5A–C). Thus, large inclusions were almost exclusively

whereas the appearance of small inclusions did not differ

between both conditions (Fig. 5A). The same pattern of

intracellular chlamydial inclusions was observed in AM isolated

community-acquired pneumonia, but not in C. pneumoniae- DNA

negative samples (Fig. 5D,E).

macrophages depend on PS

apoptotic PMN to MF we tried to inhibit the uptake of apoptotic

cells by blocking the apoptotic eat me signal PS on infected PMN.

apoptotic PMN with MF that were co- incubated with C.pneumoniae

AnxA5. Both types of MF stained positive for C.pneumoniae

pattern in MF that were infected in the presence of PS- masking

AnxA5 revealed less and smaller inclusions (Fig. 6B) similar to the

staining we observed after direct infection of macrophages (Fig. 4C

left in medium alone. Using Anxa5-fluos and propidium iodide (PI) staining we could show that both non- infected (.95%, A) and C. pneumoniaeinfected(82%

experiment out of 3). To visualize whether C. pneumoniae- infected PMN stain positive for PS we performed a double staining using a FITC- labeledanti-

doi:10.1371/journal.pone.0006020.g002

Apoptosis Driven Infection

PLoS ONE | www.plosone.org 3 June 2009 | Volume 4 | Issue 6 | e6020

and Fig. 5B). We found that AnxA5 significantly reduced the

number of large inclusions in MF, indicative for reduced bacterial

load and replicative activity (Fig. 6C, p= 0.02). Using an AnxA5-

based MACS separation system we were able to separate PSpositive

showing that only co- incubation with PS- positive PMN resulted

Furthermore, expression of the chlamydial 16S rRNA in MF was

decreased more than 2-fold when the PMN uptake was blocked by

AnxA5 (Fig. 6D, n =3). Reduced bacterial load in MF preincubated

with AnxA5 was accompanied by reduced transcriptional

activity of the rpo and pyk gene indicative for impaired

growth and progeny of chlamydiae (Fig. 6E, n =3).

silences MF immune response

PMN would induce activation or silencing of MF, and

therefore analyzed the expression of the pro- inflammatory and

significant reduction of TNF-a release from MF after uptake of C.pneumoniae

infection with C. pneumoniae (Fig. 7A, p= 0.01). In contrast, PMNthat were not- infected by

necrotic after 3 days, and the uptake of these late apoptotic PMN

macrophages alone (data not shown). In contrast, the

increased the production of TGF-ß as compared to direct infection

PMN by AnxA5 pre- incubation reduced the production of TGF-ß

but without reaching statistical significance (n= 3).

Discussion

is limited outside a human host cell. The pathogen strongly

depends on the host cell environment for progeny and systemic

dissemination. Alveolar macrophages (AM) are the pre-dominant

cells in the human lung and represent the first line of defense in

respiratory infections. Upon bacterial challenge the amount of

PMN increases dramatically in the lung, accounting for more than

80% of the cells in acute respiratory tract infections. Whereas

direct infection of macrophages results in clearance of the

promote intracellular survival [4]. Nevertheless, although C.pneumoniae

infections, the infection of macrophages seems crucial for systemic

replicate inside PMN as shown by the transcriptional activity data

and increased LPS expression, however, we did not succeed to

transmit chlamydial infection from PMN to epithelial cells, which

are primarily used for culture of chlamydiae. We found that in the

presence of PMN lysates, containing high amounts of degrading

enzymes from disrupted granules, chlamydial growth was

precluded, even when epithelial cells were directly infected with

from in vivo data that the influx of PMN in acute lung infectionwith

increased bacterial load in mice [19]. In contrast, lack of PMN

recruitment in MyD88-deficient mice resulted in lower bacterial

load of infected lungs, although the underlying mechanisms for

enhanced chlamydial progeny and dissemination in the presence

of PMN remained to be explained [19]. Gueinzius et al. could

vascular endothelial cells [20]. However, mechanisms of cell to cell

transfer of obligate intracellular bacteria are largely unknown, but

it has been speculated that chlamydiae might profit from hiding

inside apoptotic cells [15]. First evidence supporting this

embryonic fibroblasts to mouse DCs [21].

Blood monocytes and monocyte- derived macrophages are

pneumoniae throughout the human body. In up to 25% of healthyblood donors

monocytes by PCR or culture [22]. Blood monocytes have been

PMN. PMN were infected with C. pneumoniae (closed circles) or mockinfected with HEp-2 lysates (open circles) (

MIP-1ß was observed in the supernatants of C. pneumoniae- infectedPMN at the given time points by ELISA (

(specific migration/migration towards medium) indicates that monocytes

p = 0.04; n = 3). Using transmission electron microscopy we could show

that C. pneumoniae- infected PMN are engulfed by monocyte- derivedmacrophages (

the macrophage; containing a complete apoptotic PMN with condensed

doi:10.1371/journal.pone.0006020.g003

Apoptosis Driven Infection

PLoS ONE | www.plosone.org 4 June 2009 | Volume 4 | Issue 6 | e6020

PMN (closed bars, 66 h p.i.) were co incubated with autologous macrophages (MF) at ratio of 1:1 (A–C). The amount of C. pneumoniae- positive (C.pneumoniae

p = 0.004), but not upon direct C. pneumoniae infection. Fluorescence microscopy revealed that co incubation of MF with C. pneumoniae- infectedapoptotic PMN for 90 h resulted in multiple large inclusions (

magnification 6306).

doi:10.1371/journal.pone.0006020.g004

at a ratio of 1:1 (closed bars, 66 h p.i.). The percentage of AM harvesting large and small inclusions were calculated 90 h p.i. by counting a minimum

of 200 cells/slide using a FITC- labeled anti- C. pneumoniae LPS- staining protocol (A). Significantly more large chlamydial inclusions were detected inAM co incubated with

fluids of patients suffering from community-acquired pneumonia (CAP) by fluorescence microscopy (D, E; representative experiment out of 4),showing both small, persistent-like inclusions (downward arrows) and large inclusions (upward arrows) in

doi:10.1371/journal.pone.0006020.g005

Apoptosis Driven Infection

PLoS ONE | www.plosone.org 5 June 2009 | Volume 4 | Issue 6 | e6020

shown to harbor viable chlamydiae [23] which allow the

transmission of the infection to endothelial or smooth muscle cells

chlamydiae enter a persistent-like state in monocytes that is

refractory to current antibiotic treatment strategies [26,27]. When

macrophages upon direct infection [24,28].

The data presented here underline the importance for C.pneumoniae

virulence in macrophages. Sheltered by the ‘‘PMN envelope’’ and

ingested by MF and AM without being visible for the innate

immune system.

The physiological clearance of tissue granulocytes is normally

silent, but can under certain situations shift to become a proinflammatory

event. For example, apoptotic cells that escape

phagocytosis, disintegrate in a pro-inflammatory process called

secondary necrosisⁱ. Importantly, uptake of non- infected late

apoptotic PMN by MF did not result in ‘‘silencing’’ of the

macrophage immune response. This is in line with findings from

Afonso et al. showing decreased intracellular survival of

Leishmania amazonensis when late apoptotic PMN were

uptaken [29]. Recent studies demonstrated that also viruses

and parasites misuse the apoptotic ‘‘eat-me signal’’ PS for

productive infection [30,31]. In general, phosphatidylserine (PS)

on the outer membrane of apoptotic cells is the key element for

induction of an anti-inflammatory environment. Therefore the

mere presence of apoptotic cells at the site of infection is

beneficial during the transfer of obligate intracellular pathogens

from one to the next host cell. Blocking experiments with AnxA5

PMN is important for the productive transfer of not only C.pneumoniae

macrophages.

tract in humans, it seems to be a footrace between direct clearance

which might increase chlamydial pathogenicity. Whether direct

the pathogen or promotes persistence of chlamydiae in the lung

still has to be determined. Morphological analysis of C. pneumoniae

suggests that direct and indirect ingestion of chlamydiae may

increased pathogen activity and silenced immune response when

transferred by apoptotic PMN. However in acute infection, the

innate and acquired immune mechanisms will be turned on by

direct host-pathogen interactions in order to limit infection to the

lungs. Thus, pro- inflammatory immune responses will be

generated by direct contact of chlamydial TLR- ligands with its

specific receptors [19,32] and MHC class I-restricted lysis of

dissemination of the pathogen [33].

active inside PMN and induce the release of macrophage

were phagocytosed by MF and developed multiple large inclusions

resulted in a persistent-like infection. Efficient uptake and

PMN was dependent on the expression of phosphatidylserine on

pathways of apoptotic cell clearance to survive inside human cells.

Further studies are needed to elucidate the functional role of this

PMN by preincubation with recombinant AnxA5 significantly reduced the uptake of chlamydiae (A, B) and the formation of large inclusions (C,p = 0.02; n = 3) as shown by fluorescence microscopy with FITC- labeled anti-

magnification 6306) and calculation of a minimum of 200 cells/slide (C). Replicative activity of C. pneumoniae, indicated by the amount of 16S rRNA(

PMN were preincubated with AnxA5 (representative experiment out of 3).

doi:10.1371/journal.pone.0006020.g006

Apoptosis Driven Infection

PLoS ONE | www.plosone.org 6 June 2009 | Volume 4 | Issue 6 | e6020

mechanism in the dissemination of chlamydiae from the lung to

the circulation in humans after acute respiratory infection.

Materials and Methods

Bacterial strain, cell preparation and infection

experiments

from a coronary artery plaque and continuously propagated on

HEp-2 cells as described [34].

PMN and monocyte- derived macrophages (MF) were generated

from buffy coat blood as described previously [4,35]. Alveolar

macrophages (AM) were isolated from bronchoalveolar lavage

negative) and patients with acute C. pneumoniae infection as provenby

Cells were cultured for 1 to 4 days at 37uC in a humidifiedatmosphere (5% CO

2-mercaptoethanol, 2 mM L-glutamine, 10 mM HEPES complemented

with 10% FCS (all Sigma-Aldrich, Munich, Germany).

ratio of 1:1 (MOI 1), equivalent amounts of heat-killed C.pneumoniae

controls. 3 hours after co incubation PMN were separated from

PMN (66 h p.i.) at a PMN to macrophage ratio of 1:1, or

directly infected with C. pneumoniae with a MOI 1. Blockingexperiments for phosphatidylserine specific uptake of

infected PMN were performed with recombinant Annexin A5

(AnxA5; Responsif GmbH, Erlangen Germany) at a concentration

of 5 mg/16106 PMN.

Immunohistochemistry, Western blot analysis and

electron microscopy of infected cells

fixed in methanol and stained using a FITC-conjugated

Germany) or a FITC-conjugated isotype matched control mAb

(Dako), followed by counterstaining with Evans blue. Inclusion

microscope fitted with HRS- AxiocamH and Axiovision software4.5

counting a minimum of 200 cells/slide. For structure preservation

examined with a Philips EM 400 electron microscope as described

[35].

Flow cytometry analysis

analysis. Cells were permeabilized using the Cytofix/Cytoperm

Plus Kit (BD Biosciences, Heidelberg, Germany) as recommended

Annexin A5 (AnxA5), propidium iodide and TUNEL staining

were performed as described [4]. In addition we stained cells with

pneumoniae LPS staining as described above. To maintain AnxA5binding to PS the intracellular

performed in the presence of 5 mM CaCl2.

Real-Time PCR

Total RNA isolation, generation of cDNA and PCR amplification

was performed as described [36]. The expression of the

chlamydial 16S rRNA (forward [TCG CCT GGG AAT AAG

AGA GA]; reverse [AAT GCT GAC TTG GGG TTG AG]),

rpoA (forward [GCAATCGAAGGGGTTATTGA]; reverse

[TGATCTGGGTTAACG GCTTC]), pyk (forward [AGC

TTG CGG ATG GAA TTA TG]; reverse [ATG CAG TTT

CCC CTG ACA AC]), and 18S rRNA (forward [TCA AGA

ACG AAA GTC GGA GG], reverse [GGA CAT CTA AGG

GCA TCA CA]) was analyzed by relative quantification using the

expression profile over time were calculated by comparing values

for 66 h p.i. to values for 3 h p.i. which were set to 1 for clear

presentation.

Cytokine measurement and chemotaxis assay

Cells were cultured and supernatants were collected after given

Systems, Wiesbaden, Germany) according to the manufacturer’s

instructions (duplicate assays for at least 3 independent experiments).

Chemotaxis assays were performed with freshly isolated

monocytes in 24-well Transwell plates (Costar, Bodenheim,

Germany) as described before [35]. The chemotactic index (CI)

was calculated by dividing the number of migrated cells towards

the number of cells migrated in medium alone.

Figure 7. Silencing of MF immune response to chlamydial

pneumoniae- infected MF were analyzed in comparison to MF eitherco incubated with

AnxA5. Within 18 h p.i. supernatants of MF were collected to determine

total amounts of TNF-a (A) and TGF-ß (B) by ELISA. Direct infection ofMF with

apoptotic PMN was characterized by a significant up regulation of

doi:10.1371/journal.pone.0006020.g007

Apoptosis Driven Infection

PLoS ONE | www.plosone.org 7 June 2009 | Volume 4 | Issue 6 | e6020

Statistical analysis

Statistical significance of the results was analyzed with Student’s t

statistically significant at p,0.05 (*) and p,0.005 (**).

Supporting Information

Blocking of phosphatidylserine (PS) expression on C. trachomatis(L2)

significantly reduced the uptake of chlamydiae (n= 4, p = 0.005).

counting a minimum of 200 cells/slide stained with FITC- labeled

anti- chlamydial - LPS staining.

Found at: doi:10.1371/journal.pone.0006020.s001 (0.64 MB TIF)

Acknowledgments

The authors thank Matthias Maass (University Hospital Salzburg, Austria)

for providing us with the CV-6 strain.

Author Contributions

Conceived and designed the experiments: JR GvZ. Performed the

experiments: LP CJ SM MK KD TL. Analyzed the data: JR MK KD

WS SS TL GvZ. Wrote the paper: JR GvZ. Critical discussion of the

manuscript: WS.

References

1. Gieffers J, van Zandbergen G, Rupp J, Sayk F, Kruger S, Ehlers S, Solbach W,

Maass M (2004) Phagocytes transmit Chlamydia pneumoniae from the lungs to

the vasculature. Eur Respir J 23: 506–510.

2. Yang ZP, Cummings PK, Patton DL, Kuo CC (1994) Ultrastructural lung

pathology of experimental Chlamydia pneumoniae pneumonitis in mice. J Infect

Dis 170: 464–467.

3. Jahn HU, Krull M, Wuppermann FN, Klucken AC, Rosseau S, Seybold J,

Hegemann JH, Jantos CA, Suttorp N (2000) Infection and activation of airway

epithelial cells by Chlamydia pneumoniae. J Infect Dis 182: 1678–1687.

4. van Zandbergen G, Gieffers J, Kothe H, Rupp J, Bollinger A, Aga E, Klinger M,

Brade H, Dalhoff K, Maass M, Solbach W, Laskay T (2004) Chlamydia

pneumoniae multiply in neutrophil granulocytes and delay their spontaneous

apoptosis. J Immunol 172: 1768–1776.

5. Bartels C, Maass M, Bein G, Malisius R, Brill N, Bechtel JF, Sayk F, Feller AC,

Sievers HH (1999) Detection of Chlamydia pneumoniae but not cytomegalovirus

in occluded saphenous vein coronary artery bypass grafts. Circulation 99:

879–882.

6. Quinn TC, Gaydos CA (1999) In vitro infection and pathogenesis of Chlamydia

pneumoniae in endovascular cells. Am Heart J 138: S507–S511.

7. Register KB, Davis CH, Wyrick PB, Shafer WM, Spitznagel JK (1987)

Nonoxidative antimicrobial effects of human polymorphonuclear leukocyte

granule proteins on Chlamydia spp. in vitro. Infect Immun 55: 2420–2427.

8. Rupp J, Kothe H, Mueller A, Maass M, Dalhoff K (2003) Imbalanced secretion

of IL-1beta and IL-1RA in Chlamydia pneumoniae-infected mononuclear cells

from COPD patients. Eur Respir J 22: 274–279.

9. Byrne GI (2003) Chlamydia uncloaked. Proc Natl Acad Sci U S A 100:

8040–8042.

10. Dreses-Werringloer U, Gerard HC, Whittum-Hudson JA, Hudson AP (2006)

Chlamydophila (Chlamydia) pneumoniae infection of human astrocytes and

microglia in culture displays an active, rather than a persistent, phenotype.

Am J Med Sci 332: 168–174.

11. Maurer AP, Mehlitz A, Mollenkopf HJ, Meyer TF (2007) Gene expression

profiles of Chlamydophila pneumoniae during the developmental cycle and iron

depletion-mediated persistence. PLoS Pathog 3: e83.

12. Rupp J, Gieffers J, Klinger M, van Zandbergen G, Wrase R, Maass M,

Solbach W, Deiwick J, Hellwig-Burgel T (2007) Chlamydia pneumoniae directly

interferes with HIF-1alpha stabilization in human host cells. Cell Microbiol.

13. Kaukoranta-Tolvanen SS, Teppo AM, Laitinen K, Saikku P, Linnavuori K,

Leinonen M (1996) Growth of Chlamydia pneumoniae in cultured human

peripheral blood mononuclear cells and induction of a cytokine response.

Microb Pathog 21: 215–221.

14. Yang J, Hooper WC, Phillips DJ, Tondella ML, Talkington DF (2003) Induction

of proinflammatory cytokines in human lung epithelial cells during Chlamydia

pneumoniae infection. Infect Immun 71: 614–620.

15. Byrne GI, Ojcius DM (2004) Chlamydia and apoptosis: life and death decisions

of an intracellular pathogen. Nat Rev Microbiol 2: 802–808.

16. Lauber K, Blumenthal SG, Waibel M, Wesselborg S (2004) Clearance of

apoptotic cells: getting rid of the corpses. Mol Cell 14: 277–287.

17. Lauber K, Bohn E, Krober SM, Xiao YJ, Blumenthal SG, Lindemann RK,

Marini P, Wiedig C, Zobywalski A, Baksh S, Xu Y, Autenrieth IB, Schulze-

Osthoff K, Belka C, Stuhler G, Wesselborg S (2003) Apoptotic cells induce

migration of phagocytes via caspase-3-mediated release of a lipid attraction

signal. Cell 113: 717–730.

18. Blasi F, Centanni S, Allegra L (2004) Chlamydia pneumoniae: crossing the

barriers? Eur Respir J 23: 499–500.

19. Rodriguez N, Fend F, Jennen L, Schiemann M, Wantia N, Prazeres da

Costa CU, Durr S, Heinzmann U, Wagner H, Miethke T (2005) Polymorphonuclear

neutrophils improve replication of Chlamydia pneumoniae in vivo upon

MyD88-dependent attraction. J Immunol 174: 4836–4844.

20. Gueinzius K, Magenau A, Erath S, Wittke V, Urbich C, Ferrando-May E,

Dimmeler S, Hermann C (2008) Endothelial cells are protected against

phagocyte-transmitted Chlamydophila pneumoniae infections by laminar shear

stress Gueinzius: Shear stress protects from C. pneumoniae infection 1.

Atherosclerosis 198: 256–263.

21. Ying S, Fischer SF, Pettengill M, Conte D, Paschen SA, Ojcius DM, Hacker G

(2006) Characterization of host cell deathⁱ induced by Chlamydia trachomatis.

Infect Immun 74: 6057–6066.

22. Cirino F, Webley WC, West C, Croteau NL, Andrzejewski C Jr, Stuart ES

(2006) Detection of Chlamydia in the peripheral blood cells of normal donors

using in vitro culture, immunofluorescence microscopy and flow cytometry

techniques. BMC Infect Dis 6: 23.

23. Boman J, Soderberg S, Forsberg J, Birgander LS, Allard A, Persson K, Jidell E,

Kumlin U, Juto P, Waldenstrom A, Wadell G (1998) High prevalence of

Chlamydia pneumoniae DNA in peripheral blood mononuclear cells in patients

with cardiovascular disease and in middle-aged blood donors. J Infect Dis 178:

274–277.

24. Gaydos CA, Summersgill JT, Sahney NN, Ramirez JA, Quinn TC (1996)

Replication of Chlamydia pneumoniae in vitro in human macrophages,

endothelial cells, and aortic artery smooth muscle cells. Infect Immun 64:

1614–1620.

25. Rupp J, Koch M, van Zandbergen G, Solbach W, Brandt E, Maass M (2005)

Transmission of Chlamydia pneumoniae infection from blood monocytes to

vascular cells in a novel transendothelial migration model. FEMS Microbiol Lett

242: 203–208.

26. Gieffers J, Fullgraf H, Jahn J, Klinger M, Dalhoff K, Katus HA, Solbach W,

Maass M (2001) Chlamydia pneumoniae infection in circulating human

monocytes is refractory to antibiotic treatment. Circulation 103: 351–356.

27. Peters J, Hess S, Endlich K, Thalmann J, Holzberg D, Kracht M, Schaefer M,

Bartling G, Klos A (2005) Silencing or permanent activation: host-cell responses

in models of persistent Chlamydia pneumoniae infection. Cell Microbiol 7:

1099–1108.

28. Wolf K, Fischer E, Hackstadt T (2005) Degradation of Chlamydia pneumoniae

by peripheral blood monocytic cells. Infect Immun 73: 4560–4570.

29. Afonso L, Borges VM, Cruz H, Ribeiro-Gomes FL, DosReis GA, Dutra AN,

Clarencio J, de Oliveira CI, Barral A, Barral-Netto M, Brodskyn CI (2008)

Interactions with apoptotic but not with necrotic neutrophils increase parasite

burden in human macrophages infected with Leishmania amazonensis 3.

J Leukoc Biol 84: 389–396.

30. Mercer J, Helenius A (2008) Vaccinia virus uses macropinocytosis and apoptotic

mimicry to enter host cells. Science 320: 531–535.

31. van Zandbergen G, Bollinger A, Wenzel A, Kamhawi S, Voll R, Klinger M,

Muller A, Holscher C, Herrmann M, Sacks D, Solbach W, Laskay T (2006)

Leishmania disease development depends on the presence of apoptotic

promastigotes in the virulent inoculum. Proc Natl Acad Sci U S A 103:

13837–13842.

32. Rodriguez N, Wantia N, Fend F, Durr S, Wagner H, Miethke T (2006)

Differential involvement of TLR2 and TLR4 in host survival during pulmonary

infection with Chlamydia pneumoniae 8. Eur J Immunol 36: 1145–1155.

33. Wizel B, Starcher BC, Samten B, Chroneos Z, Barnes PF, Dzuris J,

Higashimoto Y, Appella E, Sette A (2002) Multiple Chlamydia pneumoniae

vacuolar pathogen 5. J Immunol 169: 2524–2535.

34. Maass M, Harig U (1995) Evaluation of culture conditions used for isolation of

Chlamydia pneumoniae. Am J Clin Pathol 103: 141–148.

35. van Zandbergen G, Klinger M, Mueller A, Dannenberg S, Gebert A,

Solbach W, Laskay T (2004) Cutting edge: neutrophil granulocyte serves as a

vector for Leishmania entry into macrophages. J Immunol 173: 6521–6525.

36. Rupp J, Hellwig-Burgel T, Wobbe V, Seitzer U, Brandt E, Maass M (2005)

Chlamydia pneumoniae infection promotes a proliferative phenotype in the

vasculature through Egr-1 activation in vitro and in vivo. Proc Natl Acad

Sci U S A 102: 3447–3452.